Skip to main content
Download PDF

Intraperitoneal administration of mRNA encoding interleukin-12 for immunotherapy in peritoneal carcinomatosis

Journal of Nanobiotechnology volume 23, Article number: 113 (2025) Cite this article

Abstract

Peritoneal carcinomatosis is an advanced stage of cancer with very limited treatment options. Locoregional immunotherapy is being evaluated as a way to improve efficacy and limit toxicity. This study assessed the efficacy of a cationic polymer/lipid-based transfection compound in delivering mRNA molecules intraperitoneally. Our investigation of the transfer of luciferase mRNA in murine models of peritoneal carcinomatosis revealed preferential luciferase expression in the omentum upon the intraperitoneal administration of complexed mRNAs. Macrophages were identified as key cells that capture and express the mRNA complexes, and accordingly, depletion of resident macrophages led to reduced reporter luciferase expression. To explore the therapeutic potential of this approach, mRNA complexes encoding single-chain interleukin-12 (IL12), an immunostimulatory molecule (mRNA-IL12), were investigated. mRNA-IL12-treated mice exhibited a significant survival advantage in models of peritoneal carcinomatosis and acquired immune memory, as shown upon subcutaneous rechallenge. Tumor microenvironment analyses revealed increased numbers of CD4+ and CD8+ T cells with a more proliferative phenotype, accompanied by decreased myeloid populations in the omentum. Overall, our study underscores the potential of mRNA complexes for efficient mRNA delivery, eliciting effective antitumor responses and modulating the tumor microenvironment to treat peritoneal carcinomatosis.

Introduction

Peritoneal carcinomatosis (PCa) poses a formidable clinical challenge characterized by the aggressive dissemination of cancer cells within the peritoneal cavity [1, 2]. PCa commonly results from advanced-stage cancers originating from organs within the abdominal cavity. The primary cancers that most frequently lead to PCa are ovarian cancer, colorectal cancer, gastric cancer, and pancreatic cancer. Ovarian cancer has the highest incidence, with up to 70% of patients presenting with peritoneal metastases at diagnosis. Colorectal cancer also contributes significantly, with approximately 10–15% of patients developing PCa, either at their initial diagnosis or as a recurrence. Approximately 10–20% of cases of gastric cancer lead to PCa, particularly in advanced stages. Although less common, pancreatic cancer can also spread to the peritoneum in approximately 15–20% of advanced cases [3]. The intricate and interconnected nature of peritoneal structures exacerbates disease progression, fostering widespread metastatic deposits and resistance to conventional therapies. Traditional approaches, such as systemic chemotherapy and surgery, frequently fall short in achieving satisfactory outcomes, underscoring the pressing need for innovative and targeted therapeutic strategies, such as hyperthermic intraperitoneal chemotherapy [4]. Unfortunately, only approximately 25% of patients with PCa are eligible for this treatment, given the late presentation of the disease [5]. Indeed, PCa is usually diagnosed when malignant ascites (abnormal build-up of liquid in the peritoneal cavity) is present, which is indicative of an already advanced stage of the disease [6].

One promising avenue for addressing peritoneal carcinomatosis is cancer immunotherapy. The peritoneal cavity and associated tissues, notably the omentum, harbor diverse immune cell populations, and recent research has highlighted the pivotal role of the immune system in controlling peritoneal tumor growth [7]. Despite this, tumors in the peritoneum often deploy mechanisms to evade immune surveillance, favoring disease progression. Various locoregional cancer immunotherapy strategies, including adoptive T-cell therapy (e.g., CAR-T cells [8,9,10], NKT [11]), recombinant viral vectors encoding immunostimulatory molecules [12, 13], cytokines and Toll-like receptor ligands [14, 15], and bispecific monoclonal antibodies [16], have shown promise in preclinical models. Notably, the bispecific monoclonal antibody Catumaxomab, which targets EpCAM and CD3 and has been employed to treat malignant ascites, has received clinical approval [17].

In pursuit of enhanced therapeutic modalities, mRNA-based therapies have emerged as promising new options in experimental cancer research [18]. These groundbreaking therapies leverage the inherent machinery of the cell to produce specific therapeutic proteins, offering a highly targeted and personalized therapeutic approach. By utilizing the cellular translational machinery, mRNA-based therapies facilitate the localized expression of therapeutic molecules within affected tissues [19]. The application of mRNA-based therapies in oncology has gained momentum, driven by advances in nucleic acid delivery systems and an improved understanding of cancer biology [18, 20]. Among the soluble factors produced by mRNAs that have demonstrated potent antitumor activity are bispecific antibodies [21] and cytokines such as IL2 [22, 23], IL23, IL36γ [24], and IL12 alone [25] or in combination with other cytokines such as IL18 [26] or IFNα, GM-CSF, and IL15 [27]. The versatility and adaptability of mRNA as a platform provide several advantages over conventional treatments, including simpler manufacturing, reduced immunogenicity, and the potential for repeated dosing. Moreover, the intrinsic transient half-life of mRNA molecules minimizes the duration of the potential toxicities associated with traditional treatment and allows for multiple-dose regimens and combinations [28]. An essential factor for the advancement of mRNA-based medicines is the creation of safe and efficient delivery vectors. The development of lipid nanoparticles with ionizable cationic lipids has been a significant breakthrough in the field [29]. These nanoparticles exhibit liver tropism through their interaction with the low-density lipoprotein (LDL) receptor in hepatocytes [30]. More recently, lipid nanoparticles with diverse tropisms have been formulated by introducing an additional lipid [31, 32].

This study contributes to this evolving field by evaluating the efficacy of a cationic polymer/lipid-based transfection compound in delivering mRNA molecules to the peritoneum. We demonstrate that the expression levels achieved are sufficient to induce an antitumor effect in models of peritoneal carcinomatosis when the mRNA encoding interleukin-12 is used for intraperitoneal delivery.

Materials and methods

Cell lines and culture media

The MC38 colon cancer cell line was generously provided by Dr. Lieping Chen (Yale University, New Haven, CT), and Panc02.OVA cells, a gift from Dr. Sebastian Kobold (University of Munich, Germany), were utilized. MC38 cells were cultured in complete RPMI (Roswell Park Memorial Institute) medium (Gibco, Waltham, MA, USA), comprising RPMI 1640 medium with GlutaMAX™, 10% FBS (Sigma‒Aldrich, St. Louis, MO), 100 IU/mL penicillin, 100 µg/mL streptomycin (Gibco), and 50 µM 2-mercaptoethanol (Gibco). Panc02.OVA cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS, 100 IU/mL penicillin, and 100 µg/mL streptomycin. Both cell lines were incubated in a humidified incubator with 5% CO2 at 37 °C and routinely screened for mycoplasma contamination via the MycoAlert Mycoplasma Detection Kit (Lonza Group Ltd., Basel, Switzerland).

mRNA complexes

The protein sequences used for firefly luciferase and single-chain IL12 have been previously described and evaluated [10]. Codon-optimized sequences for Mus musculus were cloned and inserted into a pUC57 backbone with ampicillin resistance by GenScript (Nanjing, China). The sequence upstream of the first codon of the open reading frame (ORF) comprises the T7 promoter (TAATACGACTCACTATAGGG) and a Kozak sequence (GCCGCCACC). The stop codon was followed by two sequential β-globin 3ʹUTRs cloned head to tail and a 90–120 poly(A) tail. The sequences of the generated constructs were verified by direct sequencing and double restriction enzyme digestion. The plasmids were linearized with 100 U HindIII (NEB R0104S, New England Biolabs, Ipswich, MA, USA) for each 100 µg of plasmid for 3 h at 37 °C. Linearization was confirmed by running 0.3 µg of the digested product on a 1% agarose gel in TAE buffer. The linearized template was purified by double phenol: chloroform: isoamyl alcohol 25:24:1 organic extraction and precipitated overnight with absolute ethanol at − 20 °C. The pellet was then washed with 70% ethanol, and once the alcohol had evaporated, it was resuspended in nuclease-free water. One microgram of the DNA template was subjected to IVT via the T7 mScript_Standard mRNA Production System (Cellcript, Madison, WI, USA), which posttranscriptionally added the Cap1 structure at the 5’ end and further elongated the poly(A) tail with 150 adenines at the 3’ end. The in vitro RNA was purified with phenol: chloroform: isoamyl alcohol 25:24:1 organic extraction, followed by ammonium acetate precipitation, according to the manufacturer’s instructions. The purified mRNA was eluted in RNase-free water at 1 to 2 mg/ml and stored at − 80 °C.

For mRNA delivery, the TransIT-mRNA Transfection Kit (Mirus Bio) was utilized, yielding polymer/lipid-based formulations of mRNA. IL12-encoding mRNAs complexed with TransIT (mRNA-IL12) and Luc-encoding mRNAs complexed with TransIT (mRNA-Luc) were prepared. Ten micrograms of mRNA were prediluted in 10 µl of prewarmed DMEM and mixed with 11.2 µl of TransIT-mRNA reagent and 7.2 µl of TransIT Boost reagent. When 20 µg of mRNA was inoculated per mouse, 22.4 µl of TransIT-mRNA reagent and 14.4 µl of TransIT Boost reagent were used. Following a 4-minute incubation at room temperature (RT), 90 µl of DMEM was added to the mRNA-DMEM mixture to achieve a final volume of 100 µl per mouse, and the mixture was immediately injected intraperitoneally.

Animal handling

Female C57BL/6 mice (six to eight weeks old) from Harlan Laboratories (Barcelona, Spain) were used for in vivo experiments. The mice were housed under specific pathogen-free conditions at CIMA (Pamplona, Spain), and all the experiments received approval (R-080–19GN) from the Ethics Committee for Animal Testing at the University of Navarra.

Mice were intraperitoneally (i.p.) injected with 5 × 105 MC38 or Panc02. OVA tumor cells in a single-cell suspension (300 µl of PBS/mouse). Treatment with mRNA-IL12 (10 µg/mouse) was delivered 10 days post Panc02.OVA/MC38 tumor challenge or 10 and 13 days post MC38 tumor cell inoculation. Treatment with 20 µg/mouse of mRNA-IL12 was administered 10 days after MC38 tumor inoculation. A control group received mRNA-Luc to assess the baseline response to the mRNA molecule. For in vivo and ex vivo bioluminescence detection, 10 µg of luciferase mRNA was injected 7 days after tumor inoculation. For the subcutaneous (s.c.) tumor model, 5 × 105 MC38 tumor cells were inoculated in 100 µl of PBS each.

Mice with i.p. tumors were monitored three times a week for the development of ascites and were euthanized upon clear signs of pain and distress. For the s.c. model, tumor diameters were measured three times per week. Euthanasia was performed in accordance with the approved Ethics Committee guidelines. Blood samples were obtained via the cheek-punch technique, and the mice were anesthetized with isoflurane before blood extraction. Spleens, omentum, and peritoneal lavage samples were collected post euthanasia with CO2.

Sample processing

Peritoneal lavage samples were obtained by injecting 3 ml of ice-cold PBS into the peritoneal cavity of euthanized mice, followed by collection with the same syringe after gently massaging the peritoneum. Spleens and omentum were subsequently isolated. Peritoneal lavage samples were centrifuged at 300 × g for 10 min, and the spleens were mechanically disrupted through a 70 μm cell strainer (Thermo Fisher Scientific, Waltham, MA). Ammonium-chloride-potassium (ACK) lysis buffer was applied for 2 min to eliminate erythrocytes. After the lysis reaction was stopped with complete RPMI medium, the cells were washed and counted, and the single-cell suspensions were used for further analyses via ELISpot or multicolor flow cytometry.

For omentum processing, single-cell suspensions were prepared by digesting the previously disaggregated tissue in 1X PBS with 0.075% collagenase IV (Sigma Aldrich) for 10 min at 37 °C. The digested tissue was absorbed with a Pasteur pipette and passed through a 40 μm cell strainer (Thermo Fisher Scientific, Waltham, MA). The cells were collected after centrifugation, counted, and kept on ice until further analysis by flow cytometry.

Flow cytometry

Single-cell suspensions of splenocytes, peritoneal lavage, and omentum cells were initially stained with the Zombie NIR Fixable Viability Kit (BioLegend, San Diego, CA) for 10 min at room temperature (RT). Flow cytometry buffer (1X PBS + 2% FBS, 2 mM EDTA, 5% 100 IU/mL penicillin, and 100 µg/ml streptomycin (Gibco)) was used to wash the samples. The cells were then incubated with FcR-Block (anti-CD16/32 clone 93; BioLegend #101302) for 10 min at 4 °C. Surface or intracellular staining was performed with fluorochrome-labeled antibodies purchased from BioLegend (unless otherwise specified) for 20 min at 4 °C: BV605-TCRb (BD Biosciences), APC-AF700-TCRb, BV510-CD8a (Ly-2), PerCP-Cy5.5-CD4, BV650-CD19, PE-Cy7-CD45.2, PerCPCy5.5-CD45.2, BV421-F4/80, PE-NK1.1, APC-CD11b (BD Biosciences), FITC-CD107a (LAMP-1) (1D4B), (PE-IFN-γ (XMG1.2), BV421-TNF-α (MP6-XT22), PE-CD11b, FITC-Ly6C, BV510-Ly6G, APC-MHCII, PE Dazzel 594-CD38, BV605-CD11c. T-cell activation was analyzed by stimulating splenocytes with 1 µg/mL OVA257–264 or without antigen as a nonspecific control in the presence of GolgiStop, GolgiPlug (BD Biosciences) or an anti-CD107 antibody for 5 h. The cells were then labeled with anti-CD3 and anti-CD8 antibodies, followed by fixation and permeabilization prior to staining with anti-IFN-γ and anti-TNF-α antibodies. The Foxp3 Fixation/Permeabilization working solution (eBioscience, San Diego, California, USA) was used according to the manufacturer’s instructions for staining with AF488-Ki67 (#558616 BD Biosciences). After extensive washing, the cells were resuspended in 150–250 µl of permeabilization buffer and assayed in a CytoFLEX flow cytometer (Beckman Coulter, Brea, CA). FlowJo software (TreeStar, Ashland, OR) was used for data analysis, and fluorescence minus one (FMO) controls were used.

Cytokine analyses

An enzyme-linked immunosorbent assay (ELISA) (BD OptEIA catalog #555138 and #555256; San Diego, CA) was used to evaluate the IL12 and IFN-γ protein levels in the mouse serum following the manufacturer’s instructions. IFN-γ-producing cells were measured with an IFN-γ enzyme-linked immunosorbent spot (ELISpot) assay kit (BD-Biosciences catalog #551083, San Diego, CA). In detail, an anti-IFN-γ monoclonal antibody was used to coat a 96-well multiscreen IP plate (Millipore), which was subsequently incubated overnight (ON) at 4°C. The wells were washed and blocked for 2 h at RT with complete RPMI medium. For other experiments, 1 × 106 splenocytes were stimulated with p15E604 − 611 antigen (GeneCust, Dudelange, Luxembourg) at 10 µg/ml or with 1 × 105 irradiated MC38 tumor cells (20,000 rads). On the other hand, 4 × 105 splenocytes were added to each well and were either stimulated with 4 × 104 irradiated Panc02.OVA tumor cells (20,000 rads) or complete RPMI medium for unstimulated controls were incubated overnight at 37 °C. The wells were washed after the incubation period and then incubated for 2 h at RT with the biotinylated detection antibody. After washing, streptavidin-HRP solution was added for one hour. A total of 1X AEC substrate solution was added to the wells for 1–2 min, and the samples were then rapidly soaked in deionized water to stop the reaction. Finally, spot-forming cells were automatically counted via an ImmunoSpot automated counter after a 12-hour drying period of the plate (CTL-Immunospot, Bonn, Germany).

Luminescence detection

Seven days after MC38 i.p. tumor cell inoculation, 100 µl of the luciferase-encoding mRNA complex (10 µg/mouse) was administered intraperitoneally. Luciferase expression kinetics were assessed by in vivo bioluminescence detection via PhotonIMAGER TM (Biospace Lab, Paris, France). The mice were anesthetized, and 100 µl of luciferin (Promega, Madison, WI, USA) (20 mg/ml) was injected i.p. 6 h, 24 h, 48 h, and 72 h after the injection of mRNA-Luc. In vivo bioluminescence was measured after 5 min. Ex vivo bioluminescence was also studied 6 h after mRNA-Luc administration. After receiving 100 µl of luciferin i.p., the mice were euthanized within the following 5 min; the omentum, spleen, liver, and ovaries of each mouse were collected; and the bioluminescence intensity was assessed. To study the role of macrophages in the uptake of polymer/lipid-based formulations of mRNA, macrophages from the peritoneal cavity were depleted via the intraperitoneal administration of a clodronate-liposome mixture (200 µl per mouse, 5 mg/mL) (Liposoma Research, Amsterdam, North Holland). One day after resident macrophage depletion, in vivo and ex vivo bioluminescence detection was repeated 6 h after i.p. mRNA-Luc (10 µg/mouse) administration. M3 Vision was used to analyze the data.

Semisupervised analysis of flow cytometry data

The semisupervised analysis of flow cytometry data was performed separately depending on the tissue of origin. First, all CD45+ cells were selected via FlowJoTM software (v.10.8), and new FCS files with compensated values for these events were generated for further analysis in the R/Bioconductor environment. Before starting the analysis, we randomly selected 1 × 105 events for each FCS file, and the values were transformed with the arcsin function with a cofactor of 500. Quality control and doublet removal were performed via the flowAI package. After that, a data integration step was performed with the fastMNN function from the Seurat package. Unsupervised clustering was carried out with the buildSNNGraph function from the scran package, and dimensionality reduction was performed with the runUMAP function from Seurat. Cluster identification was manually supervised from the expression of population markers. When necessary, clusters of cells that could not be identified were removed, and a new clustering process was performed. The Mann‒Whitney test was used to assess the significance of changes in cell population quantification between groups.

Statistical analysis

GraphPad Prism version 8.2.1 software (GraphPad Software, Inc., San Diego, CA) was used for statistical analysis. Data were analyzed by two-way or one-way analysis of variance followed by Sidak’s or Tukey’s multiple comparisons tests. Survival analysis was performed via the logarithmic rank test. P values < 0.05 were considered statistically significant. The analysis used in each case is indicated in the figure legend.

Results

Intraperitoneal administration of mRNA complexes allows expression of the encoded molecule in the omentum

To assess the efficacy of polymer/lipid-based complexes in delivering mRNA molecules into the peritoneum, C57BL/6 mice bearing intraperitoneally disseminated MC38 colon cancer cells were employed as a murine model of peritoneal carcinomatosis. Seven days after tumor challenge (when the tumor cells colonized the omentum (Figure S1), 10 µg of the luciferase mRNA complex (mRNA-Luc) or PBS as a negative control was delivered intraperitoneally (Fig. 1A). Luciferase expression was quantified through in vivo bioluminescence measurement after 6 h. As shown in Fig. 1B, C and S2A, the mRNA-Luc group presented significantly greater photon emission than did the negative control.

Fig. 1
figure 1

Intraperitoneal administration of mRNA complexes allows expression of the encoded protein preferentially in omentum (A) The scheme summarizes the experimental design. A‒E. MC38 tumor-bearing C57BL/6 mice (n = 9‒12/group) received one dose of mRNA-Luc (10 µg of luciferase-encoding mRNA complexes) or PBS (control group) i.p. 7 days after tumor inoculation. Six hours later, bioluminescence intensity was measured via PhotonIMAGER in vivo (B-C) and ex vivo (D-E). (B) In vivo bioluminescence quantification (ph/s/cm2/sr) 6 h after PBS or mRNA-Luc i.p. administration. (C) Representative image of luciferase expression in vivo. (D) Six hours after PBS or mRNA-Luc i.p. administration, the omentum, spleen, liver and ovaries were collected, and ex vivo bioluminescence was quantified (ph/s/cm2/sr). (E) Image illustrating the expression of luciferase in the omentum. Student’s t tests were performed in panel B. Two-way ANOVA followed by Sidak’s multiple comparison test for panel D. **p value < 0.01, ****p value < 0.0001

Full size image

To better elucidate which intraperitoneal organ was primarily targeted by locoregional treatment, we excised the omentum, spleen, liver, and ovaries and conducted an ex vivo bioluminescence study 6 h after mRNA delivery. The omentum was the organ displaying the greatest luciferase activity, with significantly lower levels detected in the spleen, liver, and ovaries (Fig. 1D, E and S2B). To analyze whether the presence of tumors was relevant, we performed an experiment in naïve mice and tumor-bearing mice. We extended our analysis to other tissues, such as the pancreas, mesentery, small intestine, heart, and large intestine. The luciferase expression increase was greater in the omentum of tumor-bearing mice than in any other analyzed organ. However, slight increases were also observed in the pancreas, spleen, mesentery and liver. (Figures S3 and S4). Our finding that the locoregional route of administration resulted in the expression of the reporter transgene in the omentum was highly interesting, given that the omentum is an essential organ for the development of antitumor immune responses in the peritoneal cavity [7].

Furthermore, we analyzed the kinetics of expression of the mRNA-encoded luciferase. At 6 h, the first time point analyzed, the expression was at the maximum and gradually decreased to baseline levels 72 h postadministration (Figure S5).

Resident macrophages in the peritoneal cavity participate in the capture of mRNAs complex

Macrophages, crucial phagocytic immune cells highly abundant in the peritoneal cavity, play a vital role in particle uptake [7, 33,34,35]. To investigate this, we intraperitoneally administered 5 mg/mL clodronate liposomes one day before the inoculation of mRNA-Luc to deplete resident macrophages from the peritoneal cavity (Fig. 2A and S6). In vivo luciferase expression was significantly lower in mice pretreated with clodronate liposomes than in those in which macrophages were not depleted (Fig. 2B, C and S7A). Importantly, clodronate treatment did not fully abolish luciferase expression. This finding indicates that in the absence of macrophages, other cells in the peritoneum can take up mRNA complexes. Additionally, we conducted an ex vivo bioluminescence study and assessed bioluminescence intensity in the omentum, spleen, liver, and ovaries. As depicted in Fig. 2D, E, and S7B, statistically significant differences were observed in the omentum between mice that did or did not receive clodronate treatment. To investigate why these complexes were retained in the omentum, we analyzed their particle size, polydispersity index (PDI), and zeta potential using Dynamic Light Scattering (DLS) with a Zetasizer Nano Series system (Malvern Instruments, UK). As shown in Figure S8, the complexes exhibited an average particle size of 1359 nm, a high PDI of 0.658, and a zeta potential of -1.59 mV. These properties likely play a critical role in their uptake by macrophages, which are highly adept at phagocytosis. Particles larger than 0.5 μm are predominantly internalized through phagocytosis, while smaller particles (< 0.1 μm) are typically taken up via endocytosis [36, 37]. Although additional factors such as rigidity, shape, and charge may also influence uptake, the retention of these complexes in the omentum is most plausibly explained by phagocytosis mediated by resident macrophages, supporting the observed effects of the mRNA formulation.

Fig. 2
figure 2

Clodronate-depletable macrophages in the peritoneal cavity are involved in the capture and expression of mRNA complexes. (A) C57BL/6 mice were challenged i.p. with 5 × 105 MC38 colon cancer cells. Six days later, the mice were treated i.p. with PBS (control group) or 200 µl of clodronate liposome solution (5 mg/ml). One day later, mRNA-Luc (10 µg/mouse) was administered i.p., and bioluminescence intensity was measured via PhotonIMAGER in vivo and ex vivo 6 h later (n = 6/group). (B) Six hours after PBS or mRNA-Luc i.p. injection, luciferase expression was quantified (ph/s/cm2/sr) in vivo. Six mice were treated with clodronate liposomes only as a control group. (C) Representative image of luciferase expression in vivo in mice treated with mRNA-Luc alone or with the combination of clodronate liposomes and mRNA-Luc. (D) Ex vivo bioluminescence measurement (ph/s/cm2/sr) of the omentum, spleen, liver and ovaries 6 h after mRNA-Luc administration i.p. (E) Image showing luciferase expression in the omentum. One-way ANOVA for panel B and two-way ANOVA followed by Tukey’s multiple comparison test for panel D. *p value < 0.05, ****p value < 0.0001

Full size image

Antitumor effect of IL12 mRNA in the MC38 colon cancer model of peritoneal carcinomatosis

To assess whether the expression achieved in the omentum could lead to therapeutic levels of an immunostimulatory molecule, we selected interleukin-12 (IL12) as a model therapeutic molecule. We complexed mRNA encoding single-chain IL12, which consists of the p40 subunit fused to the p35 subunit with a linker peptide (mRNA-IL12).

To investigate the antitumor efficacy, we utilized C57BL/6 mice inoculated intraperitoneally with 5 × 105 MC38 colon cancer cells. Luciferase mRNA complexes exerted a detectable antitumor effect if treatment was initiated at day 6 but not at day 10 (Fig. 3A, and S9). So, ten days after tumor challenge, we administered 10 µg of luciferase mRNA or IL12 mRNA complexes i.p. and monitored survival. As illustrated in the survival graph shown in Figure S10A, mice receiving mRNA-IL12 therapy exhibited a clear prolongation in terms of overall survival, with two mice successfully rejecting their intraperitoneal disease. Throughout the experiment, we tracked the development of ascites, and we observed that all the mice that succumbed to the disease, including those treated with mRNA-IL12, had developed ascites.

Fig. 3
figure 3

IL12-encoded mRNA complexes exert antitumor effects on MC38-derived peritoneal carcinomatosis. (A) Survival of 5 × 105 MC38 i.p. tumor-bearing mice (n = 5–6/group) treated twice with PBS or mRNA-IL12 (10 µg/mouse) at days 10 and 13 or once with mRNA-Luc (20 µg/mouse), mRNA-IL12 (10 µg/mouse) or mRNA-IL12 (20 µg/mouse) on day 10 after tumor challenge. (B) MC38 cells (5 × 105) were injected subcutaneously into the mice 165 days after primary tumor challenge. Six naïve mice were used as a control group. The tumor follow-up data are shown. C‒F. MC38 cells (5 × 105) were administered i.p. to C57BL/6 mice (n = 4/group). The mice were treated i.p. twice with PBS, mRNA-Luc or mRNA-IL12 (10 µg/mouse) at days 10 and 13 after tumor inoculation. Eighteen hours after the second treatment, the mice were sacrificed, and spleen and peritoneal lavage samples were collected for further analysis. C-D. ELISAs were carried out with peritoneal lavage samples to detect IL12 and IFN-γ. E. Splenocytes were stimulated with p15E604 − 611 antigen or with 1 × 105 irradiated MC38 tumor cells (20,000 rads), and the number of IFN-γ–producing cells was measured via ELISpot. F. A representative ELISpot plate image. Log-rank (Mantel‒Cox) tests were used to analyze the survival data in panel A. The data from panel B are expressed as the means ± SDs, and repeated-measures ANOVA was used for the statistical analysis. Statistical significance was determined with one-way ANOVA followed by Tukey’s multiple comparisons tests in panels C and D. In panel E, two-way ANOVA followed by Tukey’s multiple comparisons test was performed. *p < 0.05, **p value < 0.01, ***p < 0.001, ****p < 0.0001

Full size image

Surviving mice from the mRNA-IL12 treatment group (n = 2) were subsequently s.c. inoculated with 5 × 105 MC38 tumor cells to evaluate their response to tumor rechallenge. While the five naïve mice developed subcutaneous tumors, the mice previously treated with mRNA-IL12 successfully rejected the tumors (Figure S10B). Additionally, the antitumor response in these two experimental groups following rechallenge resulted in the formation of a scar at the site of tumor cell inoculation (Figure S10C).

To improve therapeutic outcomes, we administered a single dose of 20 µg on day 10 or two doses of 10 µg at days 10 and 13. We chose a 3-day interval between doses, as our previous results revealed that mRNA expression was undetectable 3 days after i.p. administration (Figure S5). Increasing the dose of the mRNA encoding IL12 did not lead to a significant improvement in survival compared with 10 µg of mRNA-IL12 (Fig. 3A). However, with two doses of 10 µg of the IL12 mRNA complex, three out of 5 mice survived without evidence of tumor development until the end of the experiment, and the group showed a survival advantage (Fig. 3A). Interestingly, we did not observe any decrease in body weight, indicating a lack of severe side effects upon intraperitoneal administration of the mRNA encoding IL12 (Figure S11). Moreover, surviving mice treated with one dose of 20 µg (n = 1) or two doses of 10 µg (n = 3) of IL12 were able to reject a rechallenge with 5 × 105 MC38 cells 165 days after intraperitoneal primary tumor inoculation (Fig. 3B). Additional safety data were evaluated by analyzing hemograms and transaminase levels (ALT and AST). Blood samples were collected 24 h after mRNA-IL12 administration in MC38 i.p. tumor-bearing mice (Figure S12A). Compared with those in untreated mice, white blood cell (WBC) counts were significantly lower at both time points (days 11 and 14) in mice treated with mRNA-IL12, reflecting the activation of immune cells by IL12 (Figure S12C). However, the hematocrit, platelet counts, and transaminase levels remained unchanged (Figure S12B, S12D-F). Therefore, we conclude that the intraperitoneal administration of mRNA-IL12 does not induce toxic effects at the therapeutic dose.

Eighteen hours after the second dose of mRNA-IL12 was administered, both IL12 and IFN-γ were detected in the peritoneal cavity lavages by ELISA (Fig. 3C and D). Moreover, the administration of two doses of mRNA-IL12 in tumor-bearing mice elicited an adaptive antitumor-specific immune response, as observed by IFN-γ ELISpot assays (Fig. 3E and F) performed with splenocytes retrieved 1 day after the second mRNA dose.

To further validate the role of peritoneal resident macrophages in the uptake of mRNA complexes (as described in Fig. 2), an antitumor efficacy experiment was conducted in MC38 intraperitoneal tumor-bearing mice. Survival was monitored in mice treated twice with PBS or mRNA-IL12 (10 µg/mouse) on days 10 and 13 posttumor challenge. Additionally, two groups of mice, either treated with PBS or mRNA-IL12, received intraperitoneal injections of 200 µL of clodronate liposome solution (5 mg/ml) on days 9 and 12 (Figure S13A). After macrophage depletion with clodronate liposomes, mice treated with mRNA-IL12 developed peritoneal carcinomatosis and did not survive, whereas in the group with intact peritoneal macrophages treated with mRNA-IL12, survival was extended, and two out of six mice successfully rejected the intraperitoneal tumor (Figure S13B).

Finally, we compared the antitumor efficacy in the MC38 peritoneal carcinomatosis model of intravenous or intraperitoneal administration of the mRNA‒IL12 complexes. As shown in Figure S14, the antitumor efficacy achieved after intraperitoneal administration was far superior to that achieved with systemic administration.

Intraperitoneal administration of IL12-encoding mRNA complexes exerts potent antitumor effects in a peritoneal carcinomatosis model derived from Panc02.OVA pancreatic cancer cells

To further analyze the antitumor efficacy in other tumor models, C57BL/6 mice were intraperitoneally inoculated with 5 × 105 Panc02.OVA cells. On day 10 after tumor cell inoculation, the mice were injected with 10 µg of mRNA-Luc or 10 µg of mRNA-IL12 or with vehicle alone.

Initially, we assessed the translational efficiency and bioactivity of the delivered molecule by determining the systemic levels of IL12 and IFN-γ, which are well-known downstream effectors of proinflammatory cytokines [38, 39]. Serum samples collected at 6 h, 24 h, 48 h, 72 h, and 96 h after i.p. treatment were subjected to ELISA for IL12 and IFN-γ. The IL12 highest levels were detected at 6 h and remained detectable until 72 h (Fig. 4A). The encoded IL12 was shown to be efficient at triggering IFN-γ secretion, which reached its peak expression 48 h after mRNA-IL12 treatment (Fig. 4B). Notably, luciferase mRNA did not result in the detection of either of the two cytokines and was henceforth used as the irrelevant mRNA.

Fig. 4
figure 4

Intraperitoneal administration of IL12-encoding mRNA complexes results in a potent antitumor response in peritoneal Panc02.OVA peritoneal carcinomatosis model. A-G. Panc02.OVA cells (5 × 105) were injected i.p. into C57BL/6 mice. Ten days later, 10 µg of IL12 mRNAs were delivered with cationic/polymer complexes in 100 µl of free DMEM i.p. B‒C. Sera were collected from the mice at the indicated time points, and ELISAs were performed to detect IL12 and IFN-γ (n = 4/group). C. Schematic representation of the experimental design and survival follow-up of mice treated with PBS, mRNA-Luc or mRNA-IL12 i.p. 10 days after tumor challenge (n = 10/group). D. Six days after treatment, the mice were sacrificed (n = 6/group), and an ELISpot assay was used to measure the number of IFN-γ–producing splenocytes stimulated with 4 × 104 irradiated Panc02.OVA cells (20,000 rads). E. Image of two representative wells per condition from the ELISpot plate. The data from panels A-B are expressed as the means ± SDs, and repeated-measures ANOVA was used for the statistical analysis. The survival data in panel C were analyzed via log-rank (Mantel‒Cox) tests. The statistical significance in panel D was determined via two-way ANOVA followed by Tukey’s multiple comparisons test. *p value < 0.05, ****p value < 0.0001.

Full size image

Next, the therapeutic potential of mRNA-based therapy was challenged in mice bearing peritoneally diffused Panc02.OVA cells. On day 10 after tumor cell i.p. inoculation, the mice were treated with 10 µg of mRNA-Luc or 10 µg of mRNA-IL12 or injected with vehicle only (Fig. 4C). Survival analysis revealed that mRNA-IL12-treated mice had a significant survival advantage, with 7 out of 10 mice rejecting the intraperitoneal tumor and surviving without signs of pain or distress (Fig. 4C).

In conclusion, the expression levels of IL12 produced in the peritoneum via this methodology are functionally effective in vivo, leading to impaired tumor growth.

IL12-encoding mRNA complexes modulate the tumoral microenvironment of the peritoneum

To better understand the antitumor immune response, the mice were treated with either mRNA-Luc, mRNA-IL12, or vehicle alone and sacrificed six days after treatment to perform an ELISpot assay of the collected splenocytes. As shown in Fig. 4D, splenocytes derived from mice treated with mRNA-IL12 presented a significantly greater number of IFN-γ-producing cells upon ex vivo stimulation with irradiated Panc02.OVA cells compared with unstimulated splenocytes. These results indicate that mRNA-IL12 treatment promoted the generation of functional tumor-reactive lymphocytes. On the other hand, no specific immunity was detected in the other two conditions. Figure 4E shows two representative wells (per condition) of IFN-γ-producing cells on the ELISpot plate. To assess the cytotoxic potential and overall functionality of CD8+ T cells induced by mRNA-IL12 treatment, we conducted a flow cytometry analysis focusing on the expression of the degranulation marker CD107, as well as TNF-α and IFN-γ production. Splenocytes were isolated from Panc02.OVA intraperitoneal tumor-bearing mice six days after mRNA-IL12 intraperitoneal treatment. As shown in Supplementary Fig. 15A, the percentage of CD107+ CD8+ T cells was significantly greater in the mRNA-IL12-treated group than in the control group, indicating an increase in the cytotoxic activity and killing potential of CD8+ T cells in this peritoneal carcinomatosis model. Additionally, we analyzed TNF-α and IFN-γ production (Figure S15B-D). Our results revealed an increase in TNF-α-producing CD8+ T cells in mice treated with IL12 mRNA following ex vivo stimulation (Figure S15B). These findings suggest that mRNA-IL12 enhances both the cytotoxic and functional readiness of CD8+ T cells to respond to tumor cells.

To characterize the tumor microenvironment in the peritoneum further, we conducted multicolor flow cytometry analysis of single-cell suspensions from peritoneal lavage and omentum samples collected 6 days posttreatment. Lymphoid and myeloid immune populations were analyzed via the gating strategy shown in Figure S16. In the peritoneal lavage samples from the mice treated with the IL12 mRNA, there was an increase in the number of CD4+ T cells (Fig. 5A-B), and this population exhibited an increased proliferative capacity, as indicated by the Ki67 marker (Fig. 5C). Ki67 expression was also elevated in CD8+ T cells, although the percentage of this T-cell subset was not affected (Fig. 5C). A significant reduction in the NK1.1+ and myeloid cell populations was observed in the mRNA-IL12-treated group (Fig. 5B).

Fig. 5
figure 5

IL12-encoding mRNA complexes favorably modulate the microenvironment in Panc02.OVA peritoneal carcinomatosis model. 5 × 105 Panc02.OVA cells were injected i.p. into C57BL/6 mice (n = 6/group). Ten days later, 10 µg of IL12 mRNAs were delivered with cationic/polymer complexes in 100 µl of free DMEM i.p. Six days after treatment, the mice were sacrificed, and the spleens, peritoneal lavage samples and omentum were collected for further analysis via flow cytometry. Multicolor flow cytometry analysis was used to characterize the immune cells in the samples phenotypically. (A) A dimension-reduced projection of various color-coded cell types from the peritoneal lavage fluid is represented in the UMAP graphics. (B) Abundance boxplot displaying group differences. (C) Lymphoid and myeloid populations from the peritoneal lavage samples were analyzed by flow cytometry. The expression of Ki67 was assessed in CD45+CD19-TCRβ+CD4+ and CD45+CD19−TCRβ+CD8+ cells. (D) Abundance boxplot showing differences between groups. (E) UMAPs illustrating a dimension-reduced projection of different color-coded cell types from the omentum.. (F) Flow cytometry was used to evaluate the lymphoid and myeloid populations from the omentum. Statistical significance was determined with one-way ANOVA followed by Tukey’s multiple comparisons tests. *p < 0.05, **p < 0.001, ***p < 0.001, ****p < 0.0001, ns: nonsignificant

Full size image

A significant increase in the percentage of CD8+ T cells was observed in omentum samples from IL12-treated mice (Fig. 5D-E). Moreover, as depicted in Fig. 5F, these cells exhibited more pronounced proliferation, as indicated by Ki67 expression. An increase in the proliferative capacity of CD4+ T cells was also observed (Fig. 5F). mRNA-Luc and mRNA-IL12 treatment led to notable changes in the myeloid cell populations within the omental tumor microenvironment, with reductions in both M2 macrophages and granulocytes (Figure S17). These cell types are typically associated with immunosuppressive functions that can inhibit effective antitumor responses. Their depletion following mRNA treatment may contribute to a less suppressive environment, facilitating the activation and function of cytotoxic CD8+ T cells, which are essential for tumor cell elimination. Additionally, an increase in dendritic cells was observed only in the mRNA-IL12 experimental group, likely enhancing antigen presentation and T-cell priming, which supports a more robust and sustained antitumor immune response (Figure S17). Together, these shifts in the myeloid compartment suggest that mRNA-IL12 not only directly stimulates immune activation but also remodels the tumor microenvironment to reduce immunosuppression, ultimately promoting increased CD8+ T-cell activity and tumor control.

Discussion

In this study, we investigated the efficacy of cationic polymer/lipid-based complexes in delivering mRNA molecules into the peritoneum through locoregional intracavitary injection. Our results revealed robust luciferase expression in the omentum following intraperitoneal administration of the mRNA complexes, with significantly greater photon emission than in the control group injected with PBS.

The pronounced localization of luciferase expression in the omentum makes the use of mRNA complexes an interesting strategy to exploit such tissue therapeutically. The omentum is a mesothelium-lined adipose tissue that extends from the stomach and covers the bowel, and it is created from a fold of the peritoneal mesothelium [7]. Although the omentum is primarily fatty tissue, it contains clusters of leukocytes termed “milky spots”. These immune clusters, which are composed of dendritic cells, neutrophils, macrophages, innate lymphoid cells (ILC2s), T and B lymphocytes, and other cells, cooperate to support several immune responses, such as inflammation, tolerance, and fibrosis, by capturing antigens, particles, and pathogens found in the peritoneal cavity [40,41,42]. This immune organ is proposed to play a role in the development of antitumor immune responses in the peritoneal cavity [41,42,43]. The omentum has also emerged as a promising site for targeted mRNA delivery upon intracavitary administration. Comparisons with prior investigations reveal the unique advantages of our approach. Lipid nanoparticles promoted the highest expression levels of the complexed mRNA in the liver, with a diffuse signal in the abdomen [44]. More recently, the effectiveness of local nebulization of mRNA lipoplexes during pressurized intraperitoneal aerosol chemotherapy was evaluated, with the aim of increasing expression in the peritoneal cavity. This novel technique successfully localized mRNA expression in intraperitoneal tissues. Unfortunately, the evaluation did not confirm expression in the omentum [45].

Our study delves into the participation of resident macrophages in the peritoneal cavity in the uptake of mRNA complexes. The depletion of these macrophages with clodronate liposomes resulted in significantly diminished luciferase expression, highlighting the role of macrophages in capturing these complexes and regulating mRNA expression. This insight contributes to a deeper understanding of the cellular mechanisms involved in mRNA delivery.

The choice of IL12 as a model therapeutic molecule stems from its potent antitumor effects in peritoneal carcinomatosis models when expressed by viral vectors or tumor-specific T cells. Our study demonstrated that mRNA-IL12 treatment in murine models confers a significant survival advantage, with the majority of mice rejecting intraperitoneal tumors and exhibiting signs of immune memory. Interestingly, the innate immune activation triggered by unmodified mRNA resulted in tumor rejection when luciferase mRNA complexes were administered at early time points. This observation suggests that IL-12 activity may be amplified through the detection of mRNA by immune cells. This finding aligns with the literature and positions mRNA-IL12 as a promising candidate for intraperitoneal mRNA-based immunotherapy. Our exploration of the tumor microenvironment in the peritoneum revealed significant changes in immune cell populations following IL12 mRNA treatment. The numeric increases in CD4+ and CD8+ T cells with a more proliferative phenotype are consistent with the observations of efficacious antitumor immune responses. Additionally, the decrease in myeloid populations and increase in dendritic cells may indicate favorable modulation of the tumor tissue microenvironment by the IL12 mRNA.

Despite these promising findings, several limitations should be acknowledged. First, the study was conducted exclusively in murine models, which, although well-established for studying peritoneal carcinomatosis, may not fully replicate the complexity of human disease. Differences in immune system architecture and tumor biology between mice and humans may limit the translational applicability of these results. Second, the observed systemic cytokine levels, including IL12 and IFN-γ, highlight the potential for adverse effects, which require further refinement of dosing strategies or additional safety mechanisms, such as tissue-specific targeting or controlled release systems. The dose used to achieve antitumor effects is considered safe since no weight loss was observed in the treated mice. However, there are detectable systemic levels of IL12 and IFN-γ, which could lead to unwanted adverse effects. Therefore, additional mechanisms to maximize the safety profile of the expressed IL12 are desirable. Several strategies are currently being developed, such as the use of masking domains or immune cell-specific cytokines [46,47,48], which can be expressed from mRNAs. In addition to modifications in the cytokine itself, mRNA can serve as a versatile platform for delivering IL12 to specific anatomical sites [49]. It is important to localize IL12 in the tumor microenvironment to achieve higher concentrations in the tumor and reduce systemic adverse effects. This can enhance the immune response locally as well as systemically and decrease immune-suppressive populations [50]. Other methods for localized IL12 delivery include plasmid electroporation, viral vectors, and adoptive cell therapy [10, 50,51,52,53]. mRNA presents a potentially safer alternative since it is not expected to cause genotoxicity, as is the case with viral vectors, and it can offer a quicker and less expensive alternative to the complex protocols of adoptive T-cell transfer. However, mRNAs may result in low and variable expression levels among individuals, and immune responses against nonviral vectors may be triggered. Another potential limitation of repeated dosing with mRNA encoding IL12 is the induction of immunosuppressive molecules and regulatory T cells in non-responders, driven by the promotion of chronic inflammation. This phenomenon has been previously reported in other experimental settings involving prolonged exposure to IL12 [54].

Conclusion

In summary, our study illuminates the potential of mRNA complexes for efficient mRNA delivery into the peritoneum, suggesting promising therapeutic effects in murine models of peritoneal carcinomatosis. The targeted expression of IL12 in the omentum improved survival and the generation of immune memory. As we move forward, understanding the delicate balance between therapeutic efficacy and potential side effects will be crucial for translating these findings into clinical applications. Further investigations into optimal dosing regimens and strategies to enhance the safety profile of mRNA-IL12 will pave the way for its potential use in clinical settings, advancing the field of intraperitoneal mRNA therapy for peritoneal carcinomatosis.

Data availability

The data that support the findings of this study are available from the corresponding author(s) upon reasonable request.

References

  1. Sadeghi B, Arvieux C, Glehen O, et al. Peritoneal carcinomatosis from non-gynecologic malignancies: results of the EVOCAPE 1 multicentric prospective study. Cancer Jan. 2000;15(2):358–63. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/(sici)1097-0142(20000115)88:2%3C;358::aid-cncr16%3E;3.0.co;2-o

    Article  Google Scholar 

  2. Coccolini F, Gheza F, Lotti M, et al. Peritoneal carcinomatosis. World J Gastroenterol Nov. 2013;7(41):6979–94. https://doiorg.publicaciones.saludcastillayleon.es/10.3748/wjg.v19.i41.6979

    Article  CAS  Google Scholar 

  3. Aranda F, Eguren-Santamaria I, Bella A, Berraondo P, Melero I. Revisiting Intracavitary Immunotherapy of Cancer. Clin Cancer Res May. 2022;13(10):1993–5. https://doiorg.publicaciones.saludcastillayleon.es/10.1158/1078-0432.CCR-22-0201

    Article  Google Scholar 

  4. Verwaal VJ, van Ruth S, de Bree E, et al. Randomized trial of cytoreduction and hyperthermic intraperitoneal chemotherapy versus systemic chemotherapy and palliative surgery in patients with peritoneal carcinomatosis of colorectal cancer. J Clin Oncol Oct. 2003;15(20):3737–43. https://doiorg.publicaciones.saludcastillayleon.es/10.1200/JCO.2003.04.187

    Article  Google Scholar 

  5. Cortes-Guiral D, Hubner M, Alyami M, et al. Primary and metastatic peritoneal surface malignancies. Nat Rev Dis Primers Dec. 2021;16(1):91. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41572-021-00326-6

    Article  Google Scholar 

  6. Ayantunde AA, Parsons SL. Pattern and prognostic factors in patients with malignant ascites: a retrospective study. Ann Oncol May. 2007;18(5):945–9. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/annonc/mdl499

    Article  CAS  Google Scholar 

  7. Bella A, Arrizabalaga L, Di Trani CA, et al. Omentum: friend or foe in ovarian cancer immunotherapy? Int Rev Cell Mol Biol. 2022;371:117–31. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/bs.ircmb.2022.04.017

    Article  CAS  PubMed  Google Scholar 

  8. Yeku OO, Purdon TJ, Koneru M, Spriggs D, Brentjens RJ. Armored CAR T cells enhance antitumor efficacy and overcome the tumor microenvironment. Sci Rep Sep. 2017;5(1):10541. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41598-017-10940-8

    Article  CAS  Google Scholar 

  9. Katz SC, Point GR, Cunetta M, et al. Regional CAR-T cell infusions for peritoneal carcinomatosis are superior to systemic delivery. Cancer Gene Ther May. 2016;23(5):142–8. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/cgt.2016.14

    Article  CAS  Google Scholar 

  10. Di Trani CA, Cirella A, Arrizabalaga L, et al. Intracavitary adoptive transfer of IL-12 mRNA-engineered tumor-specific CD8(+) T cells eradicates peritoneal metastases in mouse models. Oncoimmunology. 2023;12(1):2147317. https://doiorg.publicaciones.saludcastillayleon.es/10.1080/2162402X.2022.2147317

    Article  PubMed  Google Scholar 

  11. Gebremeskel S, Nelson A, Walker B, et al. Natural killer T cell immunotherapy combined with oncolytic vesicular stomatitis virus or reovirus treatments differentially increases survival in mouse models of ovarian and breast cancer metastasis. J Immunother Cancer Mar. 2021;9(3). https://doiorg.publicaciones.saludcastillayleon.es/10.1136/jitc-2020-002096

  12. Alkayyal AA, Tai LH, Kennedy MA, et al. NK-Cell recruitment is necessary for eradication of peritoneal carcinomatosis with an IL12-Expressing Maraba Virus Cellular Vaccine. Cancer Immunol Res Mar. 2017;5(3):211–21. https://doiorg.publicaciones.saludcastillayleon.es/10.1158/2326-6066.CIR-16-0162

    Article  CAS  Google Scholar 

  13. Bella A, Arrizabalaga L, Di Trani CA, et al. Synergistic antitumor response with recombinant modified virus Ankara armed with CD40L and CD137L against peritoneal carcinomatosis. Oncoimmunology. 2022;11(1):2098657. https://doiorg.publicaciones.saludcastillayleon.es/10.1080/2162402X.2022.2098657

    Article  PubMed  PubMed Central  Google Scholar 

  14. Perales-Puchalt A, Svoronos N, Villarreal DO, et al. IL-33 delays metastatic peritoneal cancer progression inducing an allergic microenvironment. Oncoimmunology. 2019;8(1):e1515058. https://doiorg.publicaciones.saludcastillayleon.es/10.1080/2162402X.2018.1515058

    Article  PubMed  Google Scholar 

  15. Pauli G, Chao PH, Qin Z, Bottger R, Lee SE, Li SD. Liposomal Resiquimod for enhanced immunotherapy of peritoneal metastases of Colorectal Cancer. Pharm Oct. 2021;15(10). https://doiorg.publicaciones.saludcastillayleon.es/10.3390/pharmaceutics13101696

  16. Yeku OO, Rao TD, Laster I, et al. Bispecific T-Cell engaging antibodies against MUC16 demonstrate efficacy against ovarian Cancer in Monotherapy and in combination with PD-1 and VEGF inhibition. Front Immunol. 2021;12:663379. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fimmu.2021.663379

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Linke R, Klein A, Seimetz D. Catumaxomab: clinical development and future directions. MAbs Mar-Apr. 2010;2(2):129–36. https://doiorg.publicaciones.saludcastillayleon.es/10.4161/mabs.2.2.11221

    Article  Google Scholar 

  18. Pastor F, Berraondo P, Etxeberria I, et al. An RNA toolbox for cancer immunotherapy. Nat Rev Drug Discov Oct. 2018;17(10):751–67. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/nrd.2018.132

    Article  CAS  Google Scholar 

  19. Sahin U, Kariko K, Tureci O. mRNA-based therapeutics–developing a new class of drugs. Nat Rev Drug Discov Oct. 2014;13(10):759–80. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/nrd4278

    Article  CAS  Google Scholar 

  20. Kreiter S, Vormehr M, van de Roemer N, et al. Mutant MHC class II epitopes drive therapeutic immune responses to cancer. Nat Apr. 2015;30(7549):692–6. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/nature14426

    Article  CAS  Google Scholar 

  21. Stadler CR, Ellinghaus U, Fischer L, et al. Preclinical efficacy and pharmacokinetics of an RNA-encoded T cell-engaging bispecific antibody targeting human claudin 6. Sci Transl Med May. 2024;22(748):eadl2720. https://doiorg.publicaciones.saludcastillayleon.es/10.1126/scitranslmed.adl2720

    Article  CAS  Google Scholar 

  22. Beck JD, Diken M, Suchan M, et al. Long-lasting mRNA-encoded interleukin-2 restores CD8(+) T cell neoantigen immunity in MHC class I-deficient cancers. Cancer Cell Apr. 2024;8(4):568–e58211. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ccell.2024.02.013

    Article  CAS  Google Scholar 

  23. Berraondo P, Gomis G, Melero I. The liver as a cytokine factory working on mRNA blueprints for cancer immunotherapy. Cancer Cell Apr. 2024;8(4):502–4. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ccell.2024.02.015

    Article  CAS  Google Scholar 

  24. Hewitt SL, Bai A, Bailey D, et al. Durable anticancer immunity from intratumoral administration of IL-23, IL-36gamma, and OX40L mRNAs. Sci Transl Med Jan. 2019;30(477). https://doiorg.publicaciones.saludcastillayleon.es/10.1126/scitranslmed.aat9143

  25. Hewitt SL, Bailey D, Zielinski J et al. Intratumoral IL12 mRNA Therapy Promotes TH1 Transformation of the Tumor Microenvironment. Clin Cancer Res. Dec 1. 2020;26(23):6284–6298. https://doiorg.publicaciones.saludcastillayleon.es/10.1158/1078-0432.CCR-20-0472

  26. Cirella A, Bolanos E, Di Trani CA, et al. Intratumoral Gene transfer of mRNAs encoding IL12 in combination with decoy-resistant IL18 improves local and systemic Antitumor immunity. Cancer Immunol Res Feb. 2023;3(2):184–98. https://doiorg.publicaciones.saludcastillayleon.es/10.1158/2326-6066.CIR-22-0373

    Article  Google Scholar 

  27. Hotz C, Wagenaar TR, Gieseke F, et al. Local delivery of mRNA-encoded cytokines promotes antitumor immunity and tumor eradication across multiple preclinical tumor models. Sci Transl Med Sep. 2021;8(610):eabc7804. https://doiorg.publicaciones.saludcastillayleon.es/10.1126/scitranslmed.abc7804

    Article  CAS  Google Scholar 

  28. Berraondo P, Martini PGV, Avila MA, Fontanellas A. Messenger RNA therapy for rare genetic metabolic diseases. Gut Jul. 2019;68(7):1323–30. https://doiorg.publicaciones.saludcastillayleon.es/10.1136/gutjnl-2019-318269

    Article  CAS  Google Scholar 

  29. Hou X, Zaks T, Langer R, Dong Y. Lipid nanoparticles for mRNA delivery. Nat Rev Mater. 2021;6(12):1078–94. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41578-021-00358-0

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Paunovska K, Da Silva Sanchez AJ, Lokugamage MP, et al. The extent to which lipid nanoparticles require apolipoprotein E and low-density lipoprotein receptor for delivery changes with ionizable lipid structure. Nano Lett Dec. 2022;28(24):10025–33. https://doiorg.publicaciones.saludcastillayleon.es/10.1021/acs.nanolett.2c03741

    Article  CAS  Google Scholar 

  31. Wang X, Liu S, Sun Y, et al. Preparation of selective organ-targeting (SORT) lipid nanoparticles (LNPs) using multiple technical methods for tissue-specific mRNA delivery. Nat Protoc Jan. 2023;18(1):265–91. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41596-022-00755-x

    Article  CAS  Google Scholar 

  32. Melamed JR, Yerneni SS, Arral ML, et al. Ionizable lipid nanoparticles deliver mRNA to pancreatic beta cells via macrophage-mediated gene transfer. Sci Adv Jan. 2023;27(4):eade1444. https://doiorg.publicaciones.saludcastillayleon.es/10.1126/sciadv.ade1444

    Article  CAS  Google Scholar 

  33. Lewis CR, Dadgar N, Yellin SA, et al. Regional Immunotherapy for Peritoneal Carcinomatosis in Gastroesophageal Cancer: emerging strategies to Re-condition a maladaptive Tumor Environment. Cancers (Basel) Oct. 2023;23(20). https://doiorg.publicaciones.saludcastillayleon.es/10.3390/cancers15205107

  34. Kubicka U, Olszewski WL, Tarnowski W, Bielecki K, Ziolkowska A, Wierzbicki Z. Normal human immune peritoneal cells: subpopulations and functional characteristics. Scand J Immunol Aug. 1996;44(2):157–63. https://doiorg.publicaciones.saludcastillayleon.es/10.1046/j.1365-3083.1996.d01-297.x

    Article  CAS  Google Scholar 

  35. Krishnan V, Tallapragada S, Schaar B, et al. Omental macrophages secrete chemokine ligands that promote ovarian cancer colonization of the omentum via CCR1. Commun Biol Sep. 2020;22(1):524. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s42003-020-01246-z

    Article  CAS  Google Scholar 

  36. Baranov MV, Kumar M, Sacanna S, Thutupalli S, van den Bogaart G. Modulation of Immune responses by particle size and shape. Front Immunol. 2020;11:607945. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fimmu.2020.607945

    Article  CAS  PubMed  Google Scholar 

  37. Wroblewska A, Szczygiel A, Szermer-Olearnik B, Pajtasz-Piasecka E. Macrophages as Promising Carriers for Nanoparticle Delivery in Anticancer Therapy. Int J Nanomed. 2023;18:4521–39. https://doiorg.publicaciones.saludcastillayleon.es/10.2147/IJN.S421173

    Article  CAS  Google Scholar 

  38. Segal JG, Lee NC, Tsung YL, Norton JA, Tsung K. The role of IFN-gamma in rejection of established tumors by IL-12: source of production and target. Cancer Res Aug. 2002;15(16):4696–703.

    Google Scholar 

  39. Brunda MJ, Luistro L, Hendrzak JA, Fountoulakis M, Garotta G, Gately MK. Role of interferon-gamma in mediating the antitumor efficacy of interleukin-12. J Immunother Emphas Tumor Immunol Feb. 1995;17(2):71–7. https://doiorg.publicaciones.saludcastillayleon.es/10.1097/00002371-199502000-00001

    Article  CAS  Google Scholar 

  40. Platell C, Cooper D, Papadimitriou JM, Hall JC. The omentum. World J Gastroenterol Apr. 2000;6(2):169–76. https://doiorg.publicaciones.saludcastillayleon.es/10.3748/wjg.v6.i2.169

    Article  Google Scholar 

  41. Rangel-Moreno J, Moyron-Quiroz JE, Carragher DM, et al. Omental milky spots develop in the absence of lymphoid tissue-inducer cells and support B and T cell responses to peritoneal antigens. Immun May. 2009;30(5):731–43. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.immuni.2009.03.014

    Article  CAS  Google Scholar 

  42. Meza-Perez S, Randall TD. Immunological functions of the Omentum. Trends Immunol Jul. 2017;38(7):526–36. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.it.2017.03.002

    Article  CAS  Google Scholar 

  43. Carlow DA, Gold MR, Ziltener HJ. Lymphocytes in the peritoneum home to the omentum and are activated by resident dendritic cells. J Immunol Jul. 2009;15(2):1155–65. https://doiorg.publicaciones.saludcastillayleon.es/10.4049/jimmunol.0900409

    Article  CAS  Google Scholar 

  44. Pardi N, Tuyishime S, Muramatsu H, et al. Expression kinetics of nucleoside-modified mRNA delivered in lipid nanoparticles to mice by various routes. J Control Release Nov. 2015;10:217:345–51. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.jconrel.2015.08.007

    Article  CAS  Google Scholar 

  45. Shariati M, Zhang H, Van de Sande L, et al. High pressure nebulization (PIPAC) Versus Injection for the Intraperitoneal Administration of mRNA complexes. Pharm Res Jun. 2019;24(9):126. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s11095-019-2646-z

    Article  CAS  Google Scholar 

  46. Zou Z, Shen J, Xue D, et al. Anti-PD-1 cis-delivery of low-affinity IL-12 activates intratumoral CD8(+)T cells for systemic antitumor responses. Nat Commun Jun. 2024;3(1):4701. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41467-024-49034-1

    Article  CAS  Google Scholar 

  47. Di Trani CA, Cirella A, Arrizabalaga L, et al. Intratumoral injection of IL-12-encoding mRNA targeted to CSFR1 and PD-L1 exerts potent anti-tumor effects without substantial systemic exposure. Mol Ther Nucleic Acids. Sep 2023;12:33:599–616. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.omtn.2023.07.020

    Article  CAS  Google Scholar 

  48. Cirella A, Bolanos E, Luri-Rey C, et al. Intratumoral immunotherapy with mRNAs encoding chimeric protein constructs encompassing IL-12, CD137 agonists, and TGF-beta antagonists. Mol Ther Nucleic Acids. Sep 2023;12:33:668–82. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.omtn.2023.07.026

    Article  CAS  Google Scholar 

  49. Liu M, Hu S, Yan N, Popowski KD, Cheng K. Inhalable extracellular vesicle delivery of IL-12 mRNA to treat lung cancer and promote systemic immunity. Nat Nanotechnol Apr. 2024;19(4):565–75. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41565-023-01580-3

    Article  CAS  Google Scholar 

  50. Nguyen KG, Vrabel MR, Mantooth SM, et al. Localized Interleukin-12 for Cancer Immunotherapy. Front Immunol. 2020;11:575597. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fimmu.2020.575597

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  51. Bella A, Arrizabalaga L, Di Trani CA, et al. Intraperitoneal administration of a modified vaccinia virus Ankara confers single-chain interleukin-12 expression to the omentum and achieves immune-mediated efficacy against peritoneal carcinomatosis. J Immunother Cancer Nov. 2023;11(11). https://doiorg.publicaciones.saludcastillayleon.es/10.1136/jitc-2023-006702

  52. Koneru M, Purdon TJ, Spriggs D, Koneru S, Brentjens RJ. IL-12 secreting tumor-targeted chimeric antigen receptor T cells eradicate ovarian tumors in vivo. Oncoimmunology Mar. 2015;4(3):e994446. https://doiorg.publicaciones.saludcastillayleon.es/10.4161/2162402X.2014.994446

    Article  CAS  Google Scholar 

  53. Crettaz J, Otano I, Ochoa-Callejero L, et al. Treatment of chronic viral hepatitis in woodchucks by prolonged intrahepatic expression of interleukin-12. J Virol Mar. 2009;83(6):2663–74. https://doiorg.publicaciones.saludcastillayleon.es/10.1128/JVI.02384-08

    Article  CAS  Google Scholar 

  54. Zabala M, Lasarte JJ, Perret C, et al. Induction of immunosuppressive molecules and regulatory T cells counteracts the antitumor effect of interleukin-12-based gene therapy in a transgenic mouse model of liver cancer. J Hepatol Dec. 2007;47(6):807–15. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.jhep.2007.07.025

    Article  CAS  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This study was supported by projects PI23/00203 and PI22/00147, financed by Instituto de Salud Carlos III and co-financed by the European Union, and Gobierno de Navarra Proyecto ARNMUNE Ref.: 0011–1411–2023. Work was produced with the support of a 2022 Leonardo Grant for Researchers and Cultural Creators (BBVA Foundation). F.A. receives a Miguel Servet I (CP19/00114) contract from ISCIII (Instituto de Salud Carlos III), cofinanced by FSE (Fondo Social Europeo). L.A. is the recipient of an FPU grant from The Spanish Ministry of Education and Professional training (FPU21/00042).

Author information

Author notes

  1. Fernando Aranda and Pedro Berraondo contributed equally to this work.

Authors and Affiliations

  1. Program of Immunology and Immunotherapy, Cancer Center Clínica, Cima Universidad de Navarra, Universidad de Navarra (CCUN), Avenida Pio XII, 55, Pamplona, Spain

    Leire Arrizabalaga, Claudia Augusta Di Trani, Myriam Fernández-Sendin, Ángela Bella, Joan Salvador Russo-Cabrera, Celia Gomar, Nuria Ardaiz, Virginia Belsue, José González-Gomariz, Adrián Gil-Korilis, Ignacio Melero, Fernando Aranda & Pedro Berraondo

  2. Navarra Institute for Health Research (IDISNA), Pamplona, Spain

    Leire Arrizabalaga, Claudia Augusta Di Trani, Myriam Fernández-Sendin, Ángela Bella, Joan Salvador Russo-Cabrera, Celia Gomar, Nuria Ardaiz, Virginia Belsue, José González-Gomariz, Sara Zalba, Adrián Gil-Korilis, Maria J. Garrido, Ignacio Melero, Fernando Aranda & Pedro Berraondo

  3. Department of Pharmaceutical Sciences, School of Pharmacy & Nutrition, University of Navarra, Pamplona, Spain

    Sara Zalba & Maria J. Garrido

  4. Spanish Center for Biomedical Research Network in Oncology (CIBERONC), Madrid, Spain

    Ignacio Melero & Pedro Berraondo

  5. Department of Oncology, Cancer Center Clínica, Universidad de Navarra (CCUN), Madrid, Spain

    Ignacio Melero

  6. Nuffield Department of Medicine (NDM), University of Oxford, Oxford, UK

    Ignacio Melero

Authors
  1. Leire Arrizabalaga
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Claudia Augusta Di Trani
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Myriam Fernández-Sendin
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Ángela Bella
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Joan Salvador Russo-Cabrera
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Celia Gomar
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Nuria Ardaiz
    View author publications

    You can also search for this author inPubMed Google Scholar

  8. Virginia Belsue
    View author publications

    You can also search for this author inPubMed Google Scholar

  9. José González-Gomariz
    View author publications

    You can also search for this author inPubMed Google Scholar

  10. Sara Zalba
    View author publications

    You can also search for this author inPubMed Google Scholar

  11. Adrián Gil-Korilis
    View author publications

    You can also search for this author inPubMed Google Scholar

  12. Maria J. Garrido
    View author publications

    You can also search for this author inPubMed Google Scholar

  13. Ignacio Melero
    View author publications

    You can also search for this author inPubMed Google Scholar

  14. Fernando Aranda
    View author publications

    You can also search for this author inPubMed Google Scholar

  15. Pedro Berraondo
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

L.A., I.M., P.B., and F.A. conceived the idea of study. L.A., C.A.D.T., M.F.-S., Á.B., J.S.R.-C., C.G., N.A., V.B., J.G.-G., S.Z., A.G-K. and M.J.G. performed the experiments. L.A, C.A.D.T, J.G.-G., I.M., F.A., P.B. conducted the data analysis. L.A. and P.B. contributed to the writing of the manuscript. All authors approved the manuscript submission.

Corresponding authors

Correspondence to Fernando Aranda or Pedro Berraondo.

Ethics declarations

Ethics approval and consent to participate

All the experiments received approval (R-080–19GN) from the Ethics Committee for Animal Testing at the University of Navarra.

Consent for publication

Not applicable.

Competing interests

Ignacio Melero reports receiving commercial research grants from AstraZeneca, BMS, Highlight Therapeutics, Alligator, Pfizer Genmab and Roche; has received speakers bureau honoraria from MSD; and is a consultant or advisory board member for BMS, Roche, AstraZeneca, Genmab, Pharmamar, F-Star, Bioncotech, Bayer, Numab, Pieris, Gossamer, Alligator and Merck Seron.The rest of the authors report no conflicts of interest in this work.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Arrizabalaga, L., Di Trani, C.A., Fernández-Sendin, M. et al. Intraperitoneal administration of mRNA encoding interleukin-12 for immunotherapy in peritoneal carcinomatosis. J Nanobiotechnol 23, 113 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12951-025-03196-2

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12951-025-03196-2

Keywords

Journal of Nanobiotechnology

ISSN: 1477-3155

Contact us